| Vector
pBACGK1.1 Information/Map |
 |
 
The pBACGK1.1 vector was constructed
by Kazutoyo Osoegawa at the Children's Hospital Oakland
Research Institute, in the Pieter J. de Jong's laboratory.
The vector is derived from the pBACe3.6 vector by inserting
attB1 and attB2 sites and deleting loxP and lox511 sites.
These attachment sites were introduced to facilitate
the transfer of insert DNA into other vectors system by
the GATEWAY (Invitrogen-TM) system. The vector still
maintains many features from the pBACe3.6 vector,
including: positive selection for insert DNA on sucrose
plates using the SacB gene, chloramphenicol resistance, multiple
cloning sites, T7 and SP6 promoter sequences, two Not1
restriction sites immediately flanking the eventual insert
and a homing enzyme site (PI-SceI). The sequences
of the attB1 and attB2 sites are: ACAAGTTTGTACAAAAAAGCAGGCT
and ACCCAGCTTTCTTGTACAAAGTGGT (inserted in this orientation
in the vector with the 5'nucleotide termini reflecting the
lowest vector position numbers). The attB1 and attB2 sites
are localized at positions of 11105-11129 and 2855-2879 in
the vector.
Contact BACPAC Resources ( [email protected]
) for further information regarding current availability or
ordering.
|
